Maximum gene silencing with siMAX small interfering RNA
The purpose of siRNAs is to silence several types of RNA
siRNA is a class of double-stranded RNA molecules. It plays an important role in the RNA interference (RNAi) pathway, where it interferes with the expression of specific genes with complementary nucleotide sequence.
We offer custom siRNAs annealed and ready-to-use:
- Desalted and HPLC purified
- Quantity of 20 nmol or 40 nmol
- Guaranteed purity of 85 % (HPLC purified)
- Sequence lengths from 17 - 27 bases
- Quality control by MALDI-TOF MS
A free 1ml 5x siMAX dilution buffer (30 mM HEPES, 100 mM KCl, 1 mM MgCl2, pH = 7.3) is included with each shipment.
CGE: capillary gel electrophoresis
12US
What you can expect from our siMAX siRNAs
Product specifications:
- Guaranteed purity of 85 % measured by CGE
- Fix quantity of 20 nmol or 40 nmol
- Sequence lengths: 17 - 27 bases
- Quality control by MALDI-TOF MS
- Turnaround time: 3-4 weeks
- Delivery: lyophilised in 2 ml screw cap tubes
A free 1 ml 5x siMAX dilution buffer (30 mM HEPES, 100 mM KCl, 1 mM MgCl2, pH = 7.3) is included with each shipment.
To resuspend the siMAX siRNA duplex
Avoid RNA degradation by using special precautions and by wearing protective lab clothing and gloves. All solutions should be qualified as RNAase-free and reserved only for use in RNA experiments. All RNA work spaces must be free of RNAase contamination. Add the required volume by using the provided siRNA dilution buffer to create your stock solution.
Annealing
The delivered siRNAs are annealed and ready to use. But if you want to repeat the annealing step:
- Heat the tube to 90°C for 60 - 90 sec
- Incubate at 37°C for at least one hour
Knock down gene expression effectively with 21mer siRNA
Traditional RNAi methods for gene knockdown in cells involve the use of synthetic small interfering RNAs.
21mer siRNA molecules are synthesised with either dTdT overhangs or alternate overhangs defined by you:

dsiRNA: more potent than siRNA?
27mer siRNA may show a much higher efficacy than 21mer siRNAs.
27mer siRNA, also known as Dicer-substrate RNAs, is reported to be significantly more potent than the traditional 21mer siRNA by taking advantage of Dicer's natural processing.
These dsiRNA molecules can also be chemically synthesized. The structure of these RNA duplexes is shown below:

siMAX siRNA controls
Select the sense strand of your preferred siRNA control for copying it into the siMAX siRNA order page.
siRNA control |
Sequence |
Lamin A/C µmol
|
CUGGACUUCCAGAAGAACA |
Lamin B2
|
GAGGAGGAGGAAGCCGAGU |
GAPDH
|
AUUCCAUGGCACCGUCAAG |
Luciferase GL2
|
CGUACGCGGAAUACUUCGA |
Luciferase GL3
|
CUUACGCUGAGUACUUCGA
|
Green Fluorescent Protein
|
GGCUACGUCCAGGAGCGCACC |
Non Specific Control 31% GC
|
UAAUGUAUUGGAACGCAUA |
Non Specific Control 47% GC
|
AGGUAGUGUAAUCGCCUUG |
Non Specific Control 68% GC
|
UGCGCUAGGCCUCGGUUGC |